help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Published ahead of print on January 23, 2004, doi:10.1164/rccm.200308-1203OC
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
200308-1203OCv1
169/7/801    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwarze, J.
Right arrow Articles by Openshaw, P. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwarze, J.
Right arrow Articles by Openshaw, P. J. M.
American Journal of Respiratory and Critical Care Medicine Vol 169. pp. 801-805, (2004)
© 2004 American Thoracic Society

Original Article

Latency and Persistence of Respiratory Syncytial Virus Despite T Cell Immunity

Jurgen Schwarze, Diarmund R. O'Donnell, Angela Rohwedder and Peter J. M. Openshaw

Children's Clinic, St. Josef-Hospital; Department of Medical Microbiology and Virology, Ruhr-Universität Bochum, Bochum, Germany; and Department of Respiratory Medicine, National Heart and Lung Institute, Imperial College London, London, United Kingdom

Correspondence and requests for reprints should be addressed to Peter J. M. Openshaw, M.D., Department of Respiratory Medicine, Imperial College London, Norfolk Place, Paddington, London W2 1PG, UK. E-mail: p.openshaw{at}ic.ac.uk


   ABSTRACT
TOP
 ABSTRACT
METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Respiratory syncytial virus (RSV) causes bronchiolitis in infants, which is associated with recurrent wheezing in later childhood. There is mounting evidence that the virus becomes latent or persists in vivo, but little is known about the mechanisms of its latency, persistence, and immune evasion. We therefore infected BALB/c mice intranasally with human RSV, analyzed sequential tissue samples by direct culture and polymerase chain reaction for viral and messenger RNA, and monitored antiviral immune responses. Virus could not be detected in bronchoalveolar lavage samples beyond Day 14, but viral genomic and messenger RNA was present in lung homogenates for 100 days or more; combined depletion of CD4 and CD8 T cells allowed infective virus to be recovered. Neutralizing antibody and memory cytotoxic T cell responses were intact in mice with latent infections, and latent viral genome contained an authentic nonmutated M2 82–91 Kd cytotoxic T lymphocyte epitope. A mutation of this epitope, detected in one clone, did not assist evasion. We suggest that RSV latency depends on persistence in privileged sites rather than on viral mutation.

Key Words: respiratory syncytial viruses • virus latency • CD8-positive T lymphocytes

Respiratory syncytial virus (RSV) is a paramyxovirus of the genus pneumovirus. It is responsible for most cases of bronchiolitis, which is the commonest cause of hospitalization under 1 year of age. Children who have recovered from bronchiolitis often develop chronic and recurrent respiratory problems (1, 2) and appear prone to early allergic sensitization (2, 3). The mechanisms of these delayed effects are unknown but probably are complex and multifactorial (4). The delayed effects of severe RSV disease could in part be explained by viral persistence, which may cause chronic inflammation (5) or change patterns of local IFN, chemokine, and cytokine production (6). The mechanisms that could allow persistent RSV infection are poorly understood.

In the absence of a strong host immune response, RSV is relatively nonlytic in most cell types. Persistent infection is easy to establish in tissue culture (e.g., the BCH-4 fibroblast cell line [7] and transformed human peripheral B cells [8]) and occurs in patients with T cell immunodeficiencies (9), in nude or irradiated mice (10), and in normal guinea pigs infected with human RSV (11, 12), which develop persistent abnormalities of airway function (13). RSV persistence has also been demonstrated in local B cells of normal naturally infected cows (14) and may possibly occur in sheep (15).

Using polymerase chain reaction (PCR), RSV viral sequences have been detected in nasopharyngeal aspirates, paranasal sinus tissue, middle-ear effusion, and conjunctival brushings of infected human subjects. Cubie and coworkers (16) detected RSV RNA by in situ hybridization in archival lung tissue from infants not only if death had occurred in winter but also in some cases after death during the summer months, suggesting persistence of RSV in the lungs of these infants. RSV RNA has also been detected in nasopharyngeal aspirates of 24% of patients with chronic obstructive pulmonary disease with stable disease. This apparent latency is associated with increased levels of inflammatory markers in sputum and with enhanced disease progression (17). In a recent study of acute asthma deaths, RSV was detected in the lungs of three out of seven patients but in none of the seven control lungs (18).

Inbred strains of mice can be infected with human RSV and offer a valuable tool in the dissection of antiviral immunity. In this study, we found evidence of viral latency (e.g., viral genomic RNA) and persistence (e.g., viral messenger RNA [mRNA]) using reverse transcriptase–polymerase chain reaction in a mouse model of infection with human RSV. On the basis that cytotoxic T lymphocyte (CTL) recognition could be important in clearing virus, we studied responses to the dominant CTL epitope of the M2 protein in mice with latent infection. Surprisingly, we found no evidence for mutation in this epitope, suggesting that persistence does not require mutational escape. Some of the results of these studies have been reported previously in the form of a Ph.D. thesis (19).


   METHODS
TOP
 ABSTRACT
 METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Mice, Virus, and Experimental Protocols
Female BALB/c mice, 8 to 12 weeks of age (Harlan Olac, Bicester, UK, or Charles River, Sulzfeld, Germany), free of specific pathogens, were used under protocols approved by The Home Office (London, UK) or Regierungspräsidium Arnsberg (Germany). Human RSV, A2 or Long strain, both from American Type Culture Collection (Rockville, MD), were cultured in HEp-2 cells and assayed for infectivity as described (20). Mice were infected intranasally with 5 x 105 plaque-forming units of RSV. On selected days after infection, bronchoalveolar lavage fluid and organs were harvested for reverse transcriptase–polymerase chain reaction. CTLs were isolated from spleens. To study the effects of T cell depletion, mice were infected with RSV and after 150 days immunosuppressed by administration of 1 mg of monoclonal antibodies to CD4 (YTS 191.1 and YTA 3.1) and CD8 (YTS 169.4 and YTS 156.7). Five doses were given over 30 days, after which lungs were homogenized and subjected to RSV plaque assay on HEp-2 cells.

Reverse Transcriptase–Polymerase Chain Reaction
RNA was extracted from bronchoalveolar lavage fluid or homogenized tissue using QIAmp Blood Kit and RNeasy Midi Kit (Qiagen, Hilden, Germany). Nested PCR was performed as described (21). Synthesis of complementary DNA was primed separately for detection of genomic RNA and mRNA of each RSV gene. RSV-specific complementary DNA and PCR primers, cycle profiles, and the expected lengths for RSV G, F, NS-1, and NS-2 genes were as described (21) (see online supplement). For the M2 gene, these are listed in Table 1. Negative (water) and positive controls (total RNA from RSV-infected HEp-2 cells) were amplified in the same way. PCR products were run on an agarose gel, stained with ethidium bromide, and compared with phi-X-RF-DNA digested with Hae III (Pharmacia, Milton Keynes, UK).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Primers for dna synthesis and pcr of RSV-M2 gene

 
Sequencing of RSV M2 Gene PCR Products
PCR products were cloned using TA cloning kits (Invitrogen, Paisley, UK). Briefly, complementary DNA was ligated into the PCR vector for transformation of Escherichia coli. Positive clones were identified by Xgal staining. DNA was extracted and checked for inserts of correct size by restriction digest. Cloned PCR products were sequenced using the USB Sequenase 2.0 Kit (Amersham, Little Chalfont, UK). For annealing, primers complimentary to the middle of the amplified section of the M2 gene were used (probe A: 5' GTATAGATACCTTATCAGAA 3', probe B: 5' TTCTGATAAGGTATCTATAC 3'). For nucleotide labeling, 35S-deoxy ATP (ICN Biochemicals, Thame, UK) was used. Sequenced DNA run on acrylamide gels (SequaGel Solutions; National Diagnostics, Aylesbury, UK) was compared with A2 RSV.

Chromium Release Assays
Cells prepared from spleens were restimulated for 5 days using RSV-infected splenocytes. After restimulation, viable cells were used as effector cells. P815 cells were incubated with peptides (SYGSINNI, residues 82–90 of the RSV M2 protein; SYGSINNN, a mutation of the former; and TYQRTRALV, residues 147–155 of the influenza A nucleoprotein) and labeled with chromium-51 (Amersham). These target cells were cocultured with effector cells. Chromium release was assessed in dried supernatant using a Matrix 96 plate reader (Hewlett Packard, Reading, UK). Percentage of killing was ([experimental release - spontaneous release]/[maximum release - spontaneous release]) x 100. Spontaneous release represents counts after incubation of target cells without effectors and maximum release counts after complete cell lysis.

RSV-specific IgG ELISA
RSV-specific antibodies were detected by ELISA (22). Briefly, ELISA plates were coated with RSV antigen or HEp-2 antigen. After blocking, binding of serum samples, and washing, antigen-specific IgG antibodies were detected by rabbit anti-mouse IgG horseradish peroxidase (The Binding Site, Birmingham, UK).


   RESULTS
TOP
 ABSTRACT
 METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Latency of RSV Genome and Persistence of RSV mRNA in the Lung
Mice were infected with RSV, and lungs, peribronchial lymph nodes, spleens, bone marrow, and brains were harvested 4, 8, 14, 21, 40, and 60 days after infection; RNA was extracted. Nested PCR was performed using primers for G, F, NS-1, and NS-2 genes of RSV. In the lung, both genomic RNA and mRNA of each gene was detected throughout the experiment up to Day 60 after RSV infection (Figure 1A for G and F; NS-1 and NS-2 not shown). Noninfected control mice remained negative for RSV RNA. Consistent detection of genomic RNA and mRNA in lymph nodes was limited to the first 8 to 14 days of infection (Figure 1B for G and F; NS-1 and NS-2 not shown); no specific RNA was detected in spleens or bone marrow after infection (not shown).



View larger version (68K):
[in this window]
[in a new window]
  		Figure 1. Viral and messenger RNA (mRNA) after respiratory syncytial virus (RSV) infection. Mice were infected with RSV intranasally; on Days 2, 4, 8, 14, 21, 40, and 60, lungs and peribronchial lymph nodes were harvested, total RNA was extracted, and nested polymerase chain reaction (PCR) for RSV G and F genes performed. PCR products were separated by electrophoresis in agarose gels. Lanes 1 to 8 show genomic viral RNA and lanes 1* to 8* show mRNA in lungs (A) and in peribronchial lymph nodes (B) on indicated days after infection. Day 0 denotes uninfected mice. A typical result from one of three experiments is shown.

 
In separate experiments, the persistence of the M2 gene and mRNA was also examined. This gene codes for a protein that contains the dominant epitope for Kd-restricted CTL activity against RSV infection. In bronchoalveolar fluid, M2 gene was not detectable beyond Day 14 postinfection. In contrast, PCR on lungs harvested as late as 100 days after RSV infection revealed persistence of M2 RNA in a third (4 out of 12) of mice tested. In each mouse with persistence of the M2 RNA, sequencing showed the authentic nonmutated major M2 epitope (SYIGSINNI) to be present. M2 RNA was not detected in spleens or brains at any time.

Recovery of Infective RSV from the Lungs of Immunodepleted Mice
Virus was detected at low level (10–100 plaque-forming units/lung) by plaque assay in four of six infected and CD4/8 T cell–depleted mice but in none of the six infected control mice not subjected to immunosuppressive treatment or in mock-infected, depleted mice.

Persistence of CTL Responses to RSV
Because authentic dominant CTL epitopes were encoded by persistent RSV found in the lungs, we next tested the CTL recognition of this epitope. To this end, splenocytes were isolated from RSV-infected mice 100 days after infection and restimulated with RSV. Target cells were incubated with an M2 peptide (SYIGSINNI) representing the dominant epitope for Kd-restricted CTL. After coculture with splenocytes, cell lysis was assessed by chromium release. The specificity of the peptide SYIGSINNI for RSV-primed CTL was confirmed using splenocytes isolated on Day 21 after infection, which induced cell lysis in a peptide concentration–dependent manner (data not shown). Target cells not incubated with the M2 peptide were not lysed by these CTL. CTL activity did not differ if M2 RNA was present or absent from the lungs (Figure 2). Splenocytes from uninfected mice did not induce target cell lysis. All infected mice had RSV-specific IgG antibodies 100 days after infection (not shown).



View larger version (17K):
[in this window]
[in a new window]
  		Figure 2. Similar cytotoxic T cell activity in mice with and without persistent infection. Splenocytes harvested 100 days after RSV infection were restimulated with RSV in bulk cultures for 5 days. Cytotoxic T lymphocyte (CTL) killing was assessed by chromium release. P815 target cells were incubated with peptide (SYIGSINNI) at 10-8 M and labeled with chromium-51. Percent-specific lysis is shown at an effector: target ratio of 16:1 for RSV-infected mice (closed circles) found to be PCR positive (n = 4) or negative (n = 8) for RSV M2 gene in the lung and for uninfected mice (open circles, n = 3) (*p < 0.05 vs. noninfected).

 
Mutation of the M2 Epitope for Kd-restricted CTL Does not Explain Viral Latency
Because mutations resulting in immune evasion could be a strategy enabling viruses to persist, we sequenced the M2 epitope in 36 clones derived from lung RNA 100 days after RSV infection. In one of the clones, we detected a mutation of this epitope with deletions of two bases followed by a stop codon, resulting in a change of the amino acid in Position 9 from isoleucine to asparagine. The capacity of this mutant peptide (SYIGSINNN) to serve as an epitope for Kd - CTL was compared with SYIGSINNI. Target cells labeled with SYIGSINNN also induced CTL activity. At low-peptide concentrations, CTL responses to SYIGSINNN were weaker than those to SYIGSINNI, but at higher peptide concentrations, the mutated peptide was as effective an epitope as the parent peptide (Figure 3). Furthermore, we tested the possibility that the mutated peptide could antagonize CTL function against the nonmutated M2 epitope. Target cells were incubated with a suboptimal concentration of the dominant M2 epitope and at the same time with a range of concentrations of the mutated peptide or with an irrelevant influenza A epitope (TYQRTRALV). This influenza peptide does not induce cytotoxicity by splenocytes from RSV-infected mice (Figure 3). Coincubation with the SYIGSINNN peptide did not decrease CTL activity induced by the parent M2 epitope, indicating that it does not serve as a specific antagonist for CTL directed against RSV-infected cells (Figure 4). Addition of the influenza A peptide resulted in some nonspecific inhibition of CTL activity against SYIGSINNI.



View larger version (21K):
[in this window]
[in a new window]
  		Figure 3. Specific killing of target cells coated with relevant RSV peptides. Splenocytes harvested 21 days after RSV infection were restimulated with RSV in bulk cultures for 5 days. P815 target cells were incubated with peptides SYIGSINNI (closed circles), SYIGSINNN (closed squares), or TYQRTRALV (open triangles) at 10-12 to 10-9 M and labeled with chromium-51. In this study, a typical experiment (of three) is represented. Percent-specific lysis at an effector: target ratio of 12:1 is expressed as mean ± SD of triplicate values.

 


View larger version (21K):
[in this window]
[in a new window]
  		Figure 4. Absence of inhibitory effect of peptides on recognition of authentic peptide motif. Splenocytes harvested 21 days after RSV infection were restimulated with RSV in bulk cultures for 5 days. P815 target cells labeled with chromium-51 were incubated with agonist peptide SYIGSINNI in suboptimal concentration (10-10 M), together with putative ‘antagonist’ peptides SYIGSINNN (closed squares, open squares) or TYQRTRALV (closed triangles, open triangles) for 90 minutes. Effector to target ratios of 8:1 (open symbols) or 16:1 (filled symbols) were used. Percent inhibition of specific lysis is shown, ‘100%’ denoting maximal inhibition (i.e., no lysis) and 0% unaltered lysis, similar to that seen with SYIGSINNI alone. Each data point represents mean ± SD of triplicate values. A typical experiment (of three) is shown.

 

   DISCUSSION
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In these studies, we used reverse transcriptase–polymerase chain reaction to demonstrate the presence of RSV RNA encoding the surface proteins G and F, the matrix protein M2, and for the two nonstructural genes NS-1 and NS-2 in the lungs of RSV-infected mice up to 100 days after initial infection. Viral RNA was not present in the spleen, bone marrow, or brain, and expression in the regional lymph nodes of the lung ceased 14 days after infection. Moreover, infective virus was recovered at low levels from the lungs of some mice subjected to T cell depletion, initiated 150 days after intranasal infection.

Ahmed and coworkers (23) proposed that three conditions should be met for viral persistence to occur. First, a virus should infect without being cytopathic; second, there must be a method to maintain the viral genome; and third, the virus must avoid immune detection and elimination. The ability to infect a host cell without leading to the death of the cell would clearly be advantageous if a virus is to become persistent. RSV is poorly cytopathic in vitro and in vivo. It causes no interruption of host cell protein synthesis and often no detectable interference with cell function (24). Cells semipermissive to viral replication, such as neurons for herpes simplex virus, allow little viral gene expression thus enabling the development of latent infection even with cytolytic viruses (23). Some paramyxoviruses, such as measles virus in humans (25) and Sendai virus in mice (26), can also induce persistent infection in neurons of the central nervous system. In this study, we found no evidence that RSV infects brain tissue. In the lung, persistence of RSV in bronchial nerves is conceivable, but the cell type harboring persistent RSV has not been determined.

Maintaining the viral genome is important if the virus is to survive; if the infected cell is replicating, the genome may be diluted if it also is not replicated. DNA is comparatively stable within cells, and DNA viruses may be more likely to persist than RNA viruses, which have to contend with ribonucleases, which are abundant both intracellularly and extracellularly. In the case of retroviruses, reverse transcription enables integration of the viral genome into the host cell DNA. Other RNA viruses, not able to integrate into the host genome, may have to continue to replicate at a low level to maintain infection and maintain RNA otherwise subjected to degradation. Detection of both genomic and mRNA of RSV indicates that transcription of these genes continues well after the acute infection. This suggests that RSV may persist in the lung by means of low-grade replication. We succeeded in isolating scanty virus from the lungs of mice infected 150 days earlier by a protocol of combined depletion of CD4 and CD8 T cells but demonstrated only that this virus was able to express surface antigens in HEp-2 cells in vitro. We have not shown that this virus is capable of further growth.

The ability to avoid recognition by the immune system is likely to be another critical factor in viral persistence. Both humoral and cellular immune responses are involved in the control of RSV infection. Mice, like humans, develop virus-specific antibodies after RSV infection (27), and passive administration of such antibodies confers protection from primary infection (28–31). In mice, RSV-specific IgG was detected in the serum at high titers 100 days after infection, irrespective of detection of viral persistence. This indicates that the presence of virus-specific IgG does not preclude RSV persistence, and in some other infections persistence seems to sustain and drive the antibody response. Although neutralizing antibody can prevent infection from occurring, it is necessary for the antibody to be present at the relevant site. Intracellular virus is not accessible to circulating Ig and would not be neutralized by it.

CTLs are normally effective in eradicating virus-infected cells. For H-2d mice (BALB/c or DBA/2) that express Kd, the M2 protein of RSV is the major target for CTL and contains an immunodominant CTL epitope (SYIGSINNI [32]) that is shared by A and B RSV subgroups (33). In this study, we assessed CTL activity to this dominant epitope 100 days after RSV infection. In mice, both with and without evidence of viral persistence, CTL were almost as effective as on Day 21 postinfection in lysing target cells. This shows that RSV persistence can be established despite normal CTL activity, suggesting that CTL do not recognize cells harboring persistent virus. To explore the possibility that escape mutations in the major CTL epitope of the RSV M2 gene are the basis for this lack of recognition, we sequenced the site of this epitope in the M2 gene using RNA from mice with evidence of RSV persistence. There were indeed two mutations in one clone, resulting in a peptide (SYIGSINNN), which differed in one amino acid from its parent. This mutant peptide was almost as effective a CTL epitope as the nonmutated form. In addition, there was no evidence that the mutated peptide acted as an antagonist for the major epitope. Thus, we found no evidence that escape mutation occurred, suggesting that specific CTL are either hypofunctional in the lungs of RSV-infected mice (34) or that viral genome resides in inaccessible cells.

A lack of virus recognition by CTL may also be due to properties of the cells harboring persistent virus. In neurons, restricted expression of viral genes and low expression of major histocompatibility complex class I molecules prevents effective presentation of viral epitopes on the cell surface and thus significantly reduces CTL recognition, making neurons an immunologically privileged site for herpes simplex virus. Furthermore, viruses themselves may be able to downregulate effective epitope presentation. RSV, like other viruses, induces IFN-ß production, which leads to the expression of transporter associated with antigen processing (TAP)-1, low molecular weight peptide (LMP)-2 and LMP-7 and subsequently to upregulation of major histocompatibility complex class I production (35), resulting in enhanced epitope presentation. But there is also evidence that viruses can interfere with major histocompatibility complex class I induction. During lytic infection with herpes simplex virus, immediate early proteins act to interfere with TAP-1–dependent transport of peptides into the endoplasmic reticulum (36, 37), decreasing major histocompatibility complex class I expression on cell surfaces and thus the likelihood of T cell–mediated lysis. The nonstructural RSV proteins NS-1 and NS-2 confer resistance to antiviral effects of exogenous type I IFNs (38). Conceivably, these proteins could also inhibit effects of endogenous IFN-ß induced by RSV infection and thus reduce major histocompatibility complex class I expression.

Antigen-presenting cells of the immune system may be a privileged cell type for viral persistence with functioning epitope presentation. Viruses as different as cytomegalovirus, human immunodeficiency virus, and measles have been shown to persist in monocytes and macrophages (39–41). Persistence of RSV can be established in human macrophage cell lines (6). It is of particular interest that RSV persistence reduces the biological activity of secreted tumor necrosis factor in this model (6) and that RSV infection in human cord blood–derived macrophages and dendritic cells induces production of interleukin-10 (42). These findings raise the possibility that RSV may be able to redirect the quality of antigen presentation, possibly resulting in anergy or apoptosis of RSV-specific CTL and in some degree of RSV tolerance.

In conclusion, we present evidence of RSV latency and persistence in the lungs despite RSV-specific antibody and CTL activity against a major Kd-restricted RSV epitope. Our findings suggest that RSV persists in immunologically privileged sites within the lung, possibly neuronal cells or lymphoid cells. Latent infection could be an important source of new community outbreaks of RSV infection. Rare individuals latently infected with RSV may shed virus if immune responses are diminished due to intercurrent infections or advancing age. Favored by winter conditions and sufficient numbers of previously unexposed individuals, such persons may seed outbreaks of RSV infection, leading to the emergence of winter epidemics. In addition, latent infection could also influence immune responses to viral or nonviral antigens, including allergens. The findings that NS genes are expressed in latently infected cells and that NS genes may have specific anti-IFN effects could in part explain the adverse delayed effects of infantile bronchiolitis on the later occurrence of wheeze, asthma diagnosis, and possibly on atopic disease.


   FOOTNOTES
 
Supported by Wellcome Trust (United Kingdom) Program grant 054797 (P.J.M.O.) and by grant 01GC9802 from Bundes-Ministerium für Bildung und Forschung, Germany (J.S.).

This article has an online supplement, which is accessible from this issue's table of contents online at www.atsjournals.org

Conflict of Interest Statement: J.S. has no declared conflict of interest; D.R.O. has no declared conflict of interest; A.R. has no declared conflict of interest; P.J.M.O. has no declared conflict of interest.

Received in original form August 29, 2003; accepted in final form January 16, 2004


   REFERENCES
TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Stein RT, Sherrill D, Morgan WJ, Holberg CJ, Halonen M, Taussig LM, Wright AL, Martinez FD. Respiratory syncytial virus in early life and risk of wheeze and allergy by age 13 years. Lancet 1999;354:541–545.[CrossRef][Medline]
  2. Sigurs N, Bjarnason R, Sigurbergsson F, Kjellman B. Respiratory syncytial virus bronchiolitis in infancy is an important risk factor for asthma and allergy at age 7. Am J Respir Crit Care Med 2000;161:1501–1507.[Abstract/Free Full Text]
  3. Schauer U, Hoffjan S, Bittscheidt J, Kochling A, Hemmis S, Bongartz S, Stephan V. RSV bronchiolitis and risk of wheeze and allergic sensitisation in the first year of life. Eur Respir J 2002;20:1277–1283.[Abstract/Free Full Text]
  4. Openshaw PJM. Potential mechanisms causing delayed effects of respiratory syncytial virus infection. Am J Respir Crit Care Med 2001;163:S10–S13.[Free Full Text]
  5. Southern P, Oldstone MBA. Medical consequences of persistent viral infection. N Engl J Med 1986;314:359–367.[Medline]
  6. Guerrero-Plata A, Ortega E, Gomez B. Persistence of respiratory syncytial virus in macrophages alters phagocytosis and pro-inflammatory cytokine production. Viral Immunol 2001;14:19–30.[CrossRef][Medline]
  7. Fernie BF, Ford EC, Gerin JL. The development of BALB/c cells persistently infected with respiratory syncytial virus: presence of ribonucleoprotein on the cell surface. Proc Soc Exp Biol Med 1981;167:83–86.[Medline]
  8. Bangham CRM, McMichael AJ. Specific human cytotoxic T cells recognise B cell lines persistently infected with respiratory syncytial virus. Proc Natl Acad Sci U S A 1986;83:9183–9187.[Abstract/Free Full Text]
  9. Couch RB, Englund JA, Whimbey E. Respiratory viral infections in immunocompetent and immunocompromised persons. Am J Med 1997;102:2–9.[Medline]
  10. Cannon MJ, Stott EJ, Taylor G, Askonas BA. Clearance of persistent respiratory syncytial virus infections in immunodeficient mice following transfer of primed T cells. Immunology 1987;62:133–138.[Medline]
  11. Bramley AM, Vitalis TZ, Wiggs BR, Hegele RG. Effects of respiratory syncytial virus persistence on airway responsiveness and inflammation in guinea-pigs. Eur Respir J 1999;14:1061–1067.[Abstract]
  12. Hegele RG, Hayashi S, Bramley AM, Hogg JC. Persistence of respiratory syncytial virus genome and protein after acute bronchiolitis in guinea pigs. Chest 1994;105:1848–1854.[Abstract/Free Full Text]
  13. Riedel F, Oberdieck B, Streckert HJ, Philippou S, Krusat T, Marek W. Persistence of airway hyperresponsiveness and viral antigen following respiratory syncytial virus bronchiolitis in young guinea-pigs. Eur Respir J 1997;10:639–645.[Abstract]
  14. Valarcher JF, Bourhy H, Lavenu A, Bourges-Abella N, Roth M, Andreoletti O, Ave P, Schelcher F. Persistent infection of B lymphocytes by bovine respiratory syncytial virus. Virology 2001;291:55–67.[CrossRef][Medline]
  15. Sharma R, Woldehiwet Z. Depression of lymphocyte responses to phytohaemagglutinin in lambs experimentally infected with bovine respiratory syncytial virus. Res Vet Sci 1991;50:152–156.[Medline]
  16. Cubie HA, Duncan LA, Marshall LA, Smith NM. Detection of respiratory syncytial virus nucleic acid in archival postmortem tissue from infants. Pediatr Pathol Lab Med 1997;17:927–938.[CrossRef][Medline]
  17. Seemungal T, Harper-Owen R, Bhowmik A, Moric I, Sanderson G, Message S, Maccallum P, Meade TW, Jeffries DJ, Johnston SL, et al. Respiratory viruses, symptoms, and inflammatory markers in acute exacerbations and stable chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2001;164:1618–1623.[Abstract/Free Full Text]
  18. O'Sullivan S, Cormican L, Faul JL, Ichinohe S, Johnston SL, Burke CM, Poulter LW. Activated, cytotoxic CD8(+) T lymphocytes contribute to the pathology of asthma death. Am J Respir Crit Care Med 2001;164:560–564.[Abstract/Free Full Text]
  19. O'Donnell DR. The delayed effects of respiratory syncytial virus infection. Ph.D. thesis, Senate House Library. University of London; 1996.
  20. Cannon MJ. Microplaque immunoperoxidase detection of infectious respiratory syncytial virus in the lungs of infected mice. J Virol Methods 1987;16:293–301.[CrossRef][Medline]
  21. Rohwedder A, Keminer O, Forster J, Schneider K, Schneider E, Werchau H. Detection of respiratory syncytial virus RNA in blood of neonates by polymerase chain reaction. J Med Virol 1998;54:320–327.[CrossRef][Medline]
  22. Reuman PD, Keely SP, Schiff GM. Rapid recovery in mice after combined nasal/oral immunization with killed respiratory syncytial virus. J Med Virol 1990;32:67–72.[Medline]
  23. Ahmed R, Morrison LA, Knipe DA. Persistence of viruses. In: Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B, Straus SE, editors. Fields virology, 3rd ed. Philadelphia: Lippincott-Raven; 1996. p. 219–249.
  24. Collins PL, McIntosh K, Chanock RM. Respiratory syncytial virus. In: Fields BN, Knipe DM, Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B, Straus SE, editors. Fields virology, 3rd ed. Philadelphia: Lippincott-Raven; 1996. p. 1313–1351.
  25. Norrby E, Kristensson K. Measles virus in the brain. Brain Res Bull 1997;44:213–220.[CrossRef][Medline]
  26. Koch EM, Neubert WJ, Hofschneider PH. Lifelong persistence of paramyxovirus Sendai-6/94 in C129 mice: detection of a latent viral RNA by hybridization with a cloned genomic cDNA probe. Virology 1984;136:78–88.[CrossRef][Medline]
  27. Reuman PD, Keely SP, Schiff GM. Comparison of class and subclass antibody response to live and UV-inactivated RSV administered intranasally in mice. J Med Virol 1991;35:198–205.[Medline]
  28. Groothuis JR, Simoes EAF, Hemming VG. Study Group RSVIG: respiratory syncytial virus infection in preterm infants and the protective effects of RSV immune globulin. Pediatrics 1995;95:463–467.[Abstract/Free Full Text]
  29. Canfield SD, Simoes EA. Prevention of respiratory syncytial virus (RSV) infection: RSV immune globulin intravenous and palivizumab. Pediatr Ann 1999;28:507–514.[Medline]
  30. The IMpact-RSV Study Group. Palivizumab, a humanized respiratory syncytial virus monoclonal antibody, reduces hospitalization from respiratory syncytial virus infection in high-risk infants. Pediatrics 1998;102:531–537.[Abstract/Free Full Text]
  31. Graham BS, Davis TH, Tang Y-W, Gruber WC. Immunoprophylaxis and immunotherapy of respiratory syncytial virus-infected mice with respiratory syncytial virus-specific immune serum. Pediatr Res 1993;34:167–172.[Medline]
  32. Openshaw PJM, Anderson K, Wertz GW, Askonas BA. The 22-kilodalton protein of respiratory syncytial virus is a major target for Kd-restricted cytotoxic T lymphocytes from mice primed by infection. J Virol 1990;64:1683–1689.[Abstract/Free Full Text]
  33. Kulkarni AB, Collins PL, Bacik I, Yewdell JW, Bennink JR, Crowe JE Jr, Murphy BR. Cytotoxic T cells specific for a single peptide on the M2 protein of respiratory syncytial virus are the sole mediators of resistance induced by immunization with M2 encoded by a recombinant vaccinia virus. J Virol 1995;69:1261–1264.[Abstract]
  34. Chang J, Braciale TJ. Respiratory syncytial virus infection suppresses lung CD8+ T-cell effector activity and peripheral CD8+ T-cell memory in the respiratory tract. Nat Med 2002;8:54–60.[CrossRef][Medline]
  35. Jamaluddin M, Wang S, Garofalo RP, Elliott T, Casola A, Baron S, Brasier AR. IFN-beta mediates coordinate expression of antigen-processing genes in RSV-infected pulmonary epithelial cells. Am J Physiol Lung Cell Mol Physiol 2001;280:L248–L257.[Abstract/Free Full Text]
  36. Fruh K, Ahn K, Djaballah H, Sempe P, van Endert PM, Tampe R, Peterson PA, Yang Y. A viral inhibitor of peptide transporters for antigen presentation. Nature 1995;375:415–418.[CrossRef][Medline]
  37. Hill A, Jugovic P, York I, Russ G, Bennink J, Yewdell J, Ploegh H, Johnson D. Herpes simplex virus turns off the TAP to evade host immunity. Nature 1995;375:411–415.[CrossRef][Medline]
  38. Schlender J, Bossert B, Buchholz U, Conzelmann KK. Bovine respiratory syncytial virus nonstructural proteins NS1 and NS2 cooperatively antagonize alpha/beta interferon-induced antiviral response. J Virol 2000;74:8234–8242.[Abstract/Free Full Text]
  39. Goldman MB, Buckthal DJ, Picciotto S, O'Bryan TA, Goldman JN. Measles virus persistence in an immortalized murine macrophage cell line. Virology 1995;207:12–22.[CrossRef][Medline]
  40. Gendelman HE, Orenstein JM, Martin MA, Ferrua C, Mitra R, Phipps T, Wahl LA, Lane HC, Fauci AS, Burke DS. Efficient isolation and propagation of human immunodeficiency virus on recombinant colony-stimulating factor 1-treated monocytes. J Exp Med 1988;167:1428–1441.[Abstract/Free Full Text]
  41. Brautigam AR, Dutko FJ, Olding LB, Oldstone MB. Pathogenesis of murine cytomegalovirus infection: the macrophage as a permissive cell for cytomegalovirus infection, replication and latency. J Gen Virol 1979;44:349–359.[Abstract/Free Full Text]
  42. Bartz H, Buning-Pfaue F, Turkel O, Schauer U. Respiratory syncytial virus induces prostaglandin E2, IL-10 and IL-11 generation in antigen presenting cells. Clin Exp Immunol 2002;129:438–445.[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Exp PhysiolHome page
Y. Tan, T. Yang, S. Liu, H. Liu, Y. Xiang, F. Qu, H. Li, and X. Qin
Infection with respiratory syncytial virus alters peptidergic innervation in the lower airways of guinea-pigs
Exp Physiol, December 1, 2008; 93(12): 1284 - 1291.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
P. Hopkins, K. McNeil, F. Kermeen, M. Musk, E. McQueen, I. Mackay, T. Sloots, and M. Nissen
Human Metapneumovirus in Lung Transplant Recipients and Comparison to Respiratory Syncytial Virus
Am. J. Respir. Crit. Care Med., October 15, 2008; 178(8): 876 - 881.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Microbiol. Rev.Home page
S. S. Mohapatra and S. Boyapalle
Epidemiologic, Experimental, and Clinical Links between Respiratory Syncytial Virus Infection and Asthma
Clin. Microbiol. Rev., July 1, 2008; 21(3): 495 - 504.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
J. Eckardt-Michel, M. Lorek, D. Baxmann, T. Grunwald, G. M. Keil, and G. Zimmer
The Fusion Protein of Respiratory Syncytial Virus Triggers p53-Dependent Apoptosis
J. Virol., April 1, 2008; 82(7): 3236 - 3249.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
P. L. Collins and B. S. Graham
Viral and Host Factors in Human Respiratory Syncytial Virus Pathogenesis
J. Virol., March 1, 2008; 82(5): 2040 - 2055.
[Full Text] [PDF]

Home page
 Proc Am Thorac SocHome page
J. Goulding, R. Snelgrove, J. Saldana, A. Didierlaurent, M. Cavanagh, E. Gwyer, J. Wales, E. L. Wissinger, and T. Hussell
Respiratory Infections: Do We Ever Recover?
Proceedings of the ATS, December 1, 2007; 4(8): 618 - 625.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
J. Harker, A. Bukreyev, P. L. Collins, B. Wang, P. J. M. Openshaw, and J. S. Tregoning
Virally Delivered Cytokines Alter the Immune Response to Future Lung Infections
J. Virol., December 1, 2007; 81(23): 13105 - 13111.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M. S. Boukhvalova, G. A. Prince, and J. C. G. Blanco
Respiratory Syncytial Virus Infects and Abortively Replicates in the Lungs in Spite of Preexisting Immunity
J. Virol., September 1, 2007; 81(17): 9443 - 9450.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
F. J. Culley, A. M. J. Pennycook, J. S. Tregoning, J. S. Dodd, G. Walzl, T. N. Wells, T. Hussell, and P. J. M. Openshaw
Role of CCL5 (RANTES) in Viral Lung Disease.
J. Virol., August 1, 2006; 80(16): 8151 - 8157.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. J. Smit, B. D. Rudd, and N. W. Lukacs
Plasmacytoid dendritic cells inhibit pulmonary immunopathology and promote clearance of respiratory syncytial virus
J. Exp. Med., May 15, 2006; 203(5): 1153 - 1159.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
T. M. A. Wilkinson, G. C. Donaldson, S. L. Johnston, P. J. M. Openshaw, and J. A. Wedzicha
Respiratory Syncytial Virus, Airway Inflammation, and FEV1 Decline in Patients with Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., April 15, 2006; 173(8): 871 - 876.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
A. R. Falsey, M. A. Formica, P. A. Hennessey, M. M. Criddle, W. M. Sullender, and E. E. Walsh
Detection of Respiratory Syncytial Virus in Adults with Chronic Obstructive Pulmonary Disease
Am. J. Respir. Crit. Care Med., March 15, 2006; 173(6): 639 - 643.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
X.-q. Li, Z. F. Fu, R. Alvarez, C. Henderson, and R. A. Tripp
Respiratory Syncytial Virus (RSV) Infects Neuronal Cells and Processes That Innervate the Lung by a Process Involving RSV G Protein
J. Virol., January 1, 2006; 80(1): 537 - 540.
[Abstract] [Full Text] [PDF]

Home page
 Antimicrob. Agents Chemother.Home page
A. Mejias, S. Chavez-Bueno, A. M. Rios, M. F. Aten, B. Raynor, E. Peromingo, P. Soni, K. D. Olsen, P. A. Kiener, A. M. Gomez, et al.
Comparative Effects of Two Neutralizing Anti-Respiratory Syncytial Virus (RSV) Monoclonal Antibodies in the RSV Murine Model: Time versus Potency
Antimicrob. Agents Chemother., November 1, 2005; 49(11): 4700 - 4707.
[Abstract] [Full Text] [PDF]

Home page
 Proc Am Thorac SocHome page
P. J. M. Openshaw
Antiviral Immune Responses and Lung Inflammation after Respiratory Syncytial Virus Infection
Proceedings of the ATS, August 1, 2005; 2(2): 121 - 125.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
M.-E. Hamelin, K. Yim, K. H. Kuhn, R. P. Cragin, M. Boukhvalova, J. C. G. Blanco, G. A. Prince, and G. Boivin
Pathogenesis of Human Metapneumovirus Lung Infection in BALB/c Mice and Cotton Rats
J. Virol., July 15, 2005; 79(14): 8894 - 8903.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Microbiol. Rev.Home page
P. J. M. Openshaw and J. S. Tregoning
Immune Responses and Disease Enhancement during Respiratory Syncytial Virus Infection
Clin. Microbiol. Rev., July 1, 2005; 18(3): 541 - 555.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
B. Nemery, W. W. Yew, R. Albert, C. Brun-Buisson, W. MacNee, F. J. Martinez, D. C. Angus, and E. Abraham
Tuberculosis, Nontuberculous Lung Infection, Pleural Disorders, Pulmonary Function, Respiratory Muscles, Occupational Lung Disease, Pulmonary Infections, and Social Issues in AJRCCM in 2004
Am. J. Respir. Crit. Care Med., March 15, 2005; 171(6): 554 - 562.
[Full Text] [PDF]

Home page
 J. Virol.Home page
R. Alvarez, K. S. Harrod, W.-J. Shieh, S. Zaki, and R. A. Tripp
Human Metapneumovirus Persists in BALB/c Mice despite the Presence of Neutralizing Antibodies
J. Virol., December 15, 2004; 78(24): 14003 - 14011.
[Abstract] [Full Text] [PDF]

Home page
 British Journal of Infection ControlHome page
Bio-researchers urged to guard their work
British Journal of Infection Control, June 1, 2004; 5(3): 6 - 7.
[PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
R. A. Tripp
The Brume Surrounding Respiratory Syncytial Virus Persistence
Am. J. Respir. Crit. Care Med., April 1, 2004; 169(7): 778 - 779.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Online Supplement
Right arrow All Versions of this Article:
200308-1203OCv1
169/7/801    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schwarze, J.
Right arrow Articles by Openshaw, P. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schwarze, J.
Right arrow Articles by Openshaw, P. J. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 2004 American Thoracic Society