help button home button
AJRCCM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BURCHARD, E. G.
Right arrow Articles by DRAZEN, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BURCHARD, E. G.
Right arrow Articles by DRAZEN, J. M.
Am. J. Respir. Crit. Care Med., Volume 160, Number 3, September 1999, 919-922

Association Between a Sequence Variant in the IL-4 Gene Promoter and FEV1 in Asthma

ESTEBAN G. BURCHARD, EDWIN K. SILVERMAN, LANNY J. ROSENWASSER, LARRY BORISH, CHANDRI YANDAVA, ANTHONY PILLARI, SCOTT T. WEISS, JEFFREY HASDAY, CRAIG M. LILLY, JEAN G. FORD, and JEFFREY M. DRAZEN

Pulmonary and Critical Care Division and Channing Laboratory, Departments of Medicine, Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts; National Jewish Medical and Research Center, Denver, Colorado; University of Maryland, Baltimore, Maryland; and Harlem Hospital Center, Columbia University, New York, New York

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Recent family-based studies have revealed evidence for linkage of human chromosome 5q31 to the diagnosis of asthma, elevated serum IgE levels, and bronchial hyperresponsiveness. Among the candidate genes in this region is the gene encoding for human interleukin-4 (IL-4). We reasoned that this gene could also serve as a candidate gene with respect to asthma severity as indicated by the FEV1 measured when bronchodilator treatment was withheld. To test this hypothesis, we examined a large population of patients with asthma (ascertained without respect to genetic characteristics), for associations between a genetic variant in the IL-4 promoter region (C-589T) and asthma severity, as indicated by FEV1. We used amplification by the polymerase chain reaction followed by BsmF1 restriction digestion to assign genotypes at the IL-4 promoter C-589T locus. We compared genotypes at this locus in 772 Caucasian and African American patients with asthma of varying severity, and we used multiple regression analysis to relate genotypic findings to FEV1. Among white individuals, the homozygous presence of the C-589T IL-4 promoter genotype (TT) was associated with a FEV1 below 50% of predicted (p = 0.013; OR, 1.44; 95% CI: 1.09 to 1.90). Subjects with the TT genotype had mean FEV1 (% predicted) values 4.5% lower than those of subjects with the wild-type (CC) genotype at this locus. FEV1 values of white patients with a CC or CT genotype were broadly distributed, whereas the TT genotype was associated with a narrow distribution of low FEV1 values. The frequency of the T allele was significantly greater (p = 1 × 10-23) among African American asthmatics (0.544) than among white asthmatics (0.183). These data provide the first evidence associating FEV1 in patients with asthma and genetic determinants at any locus. Our data are consistent with the idea that the FEV1 in asthma is the result of multiple factors; one of these factors is the genotype at the IL-4 C-589T locus. This locus is associated with a small but significant decrement in pulmonary function among white asthmatic subjects.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Asthma is a complex clinical syndrome that probably results from interactions of environmental (1, 2) and genetic (3) influences. Although the degree to which genetic factors contribute to this complex phenotype is unclear, a number of different investigative groups have used genetic linkage techniques to identify human chromosome 5q31 as a region likely to contain genes related to the diagnosis of asthma (7), elevated serum IgE levels (3, 4, 8, 9), and bronchial hyperresponsiveness (3). Among the candidate genes in this region is the gene encoding for human interleukin-4 (IL-4). Genetic variants in the promoter region of the IL-4 gene (10) have been related to elevated levels of serum IgE; this locus has been associated with the diagnosis of asthma in some studies, but not in others (11- 13). Because IL-4 stimulation can influence mast cell responsiveness to IgE-mediated signaling (14) and because genetic variants in the IL-4 promoter have the capacity to modify IL-4 gene transcription, we reasoned that these sequence variants could modify asthma severity. To address this issue, we examined a large population of patients with asthma (ascertained without respect to genetic characteristics) for associations between a genetic variant in the IL-4 promoter region and the FEV1.

    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Patients

A cohort of 772 patients participating in a controlled trial of a new asthma medication was recruited from private practice offices and university hospital clinics. To be eligible for inclusion in the trial, patients had to have asthma as defined by American Thoracic Society criteria and had to be free of significant comorbid medical conditions (15). In addition, patients had to have been clinically stable for at least 6 wk while using medium-acting beta -agonists as their only asthma treatment, could not have been hospitalized for treatment of asthma more than once in the preceding 6 mo, could not have used oral or inhaled steroids for at least 6 wk, could not have used theophylline for at least 1 wk, and had to be between 12 and 70 yr of age. Thus, patients who were not clinically stable while receiving such a regimen were excluded from the sample cohort. At their first visit, patients had to have a FEV1 (16) between 40 and 80% of predicted normal values after at least 8 h without inhaled beta -agonist treatment. Premenopausal women who were not using approved methods of contraception or who were pregnant were excluded from the trial, as were patients with a history of cigarette use for more than 10 pack-years in their lifetime and those who had smoked cigarettes at all in the 12 mo prior to the trial's initiation. The FEV1 in the absence of bronchodilator medications was used as an index of asthmatic airway obstruction (16).

All participants provided EDTA-anticoagulated samples of whole blood and returned them to a central laboratory in a cold pack by overnight courier. On arrival in the laboratory, the specimens underwent DNA extraction (as detailed below) and plasma separation and were stored at -80° C. Written informed consent, including consent for genetic testing, was obtained from each patient and control subject in a form that had been approved by the appropriate institutional review board.

Genotyping

DNA was extracted from blood samples with either a commercial kit (QIAamp Blood Kit; Qiagen, Chatsworth, CA) or an automated nucleic acid purification system (Genepure; Applied Biosystems, Foster City, CA). The C to T mutation 589 base pairs (bp) upstream of the translation start site (Genbank access M23442) in the IL-4 promoter was detected by the loss of a restriction site for the BsmF1 restriction enzyme (13). A 198-bp fragment was amplified from genomic DNA and then digested by the BsmF1 restriction enzyme as described by Walley and Cookson (13). A 5'primer (5'TGGGTAAGGACCTTATGGACC3', nucleotides -683 to -663) and a 3'primer (5'GGTGGCATCTTGGAAACTGT3', nucleotides -486 to -505) were used to amplify a 198-bp fragment from genomic DNA samples. A polymerase chain reaction (PCR) mixture containing a total volume of 15 µl included the following: 50 ng of DNA, 1.5 µl of 10× PCR Buffer (Boehringer Mannheim, Mannheim, Germany), 1.5 µl of a 200 µM solution of deoxynucleoside triphosphates (adenosine, cytidine, thymidine, and guanosine triphosphates), 6 pmol of each primer, and 1 U of Taq polymerase (Promega, Madison, WI). Samples were heated to 94° C for 6 min and then underwent 35 cycles of 94° C for 15 s, 60° C for 30 s, and 72° C for 30 s followed by a final incubation at 72° C for 5 min in a Perkin-Elmer GeneAmp PCR system 9700 (Perkin-Elmer Medical Instruments, Pomona, CA). The restriction enzyme digestion mixture was added directly to the final 15-µl PCR solution to attain a final volume of 25 µl. The digestion mixture included 2 U of BsmF1 (New England Biolabs [NBL], Beverly, MA), 2.0 µl of NBL 10× Buffer no. 4, and 0.2 µl of NBL 100× BSA (10 ng/ml). Restriction digestion was allowed to proceed for a total of 2 h at 37° C. The fragments measuring 198 bp for the (-589T allele) and 120 and 78 bp for the (-589C allele) were separated on 2% agarose gels and visualized with ethidium bromide. Each reaction was repeated and confirmed by a second independent amplification and restriction enzyme digestion. Genotype assays using the PCR technique followed by BsmF1 restriction digestion were performed and repeated. Samples that were not amplified by PCR or that were not confirmed on repeat PCR/BsmF1 restriction digestion were excluded from the study.

IgE Levels

Total plasma IgE titers were assayed in 678 patients with a commercially available system (UniCAP). The results were analyzed as log10 IgE titers because of the known logarithmic distribution of plasma IgE titers.

Statistical Analysis

All statistical analyses were performed with the SAS statistical package (SAS Statistical Institute, Cary, NC) on a SUN Microsystem. Allele frequencies in white and African American asthmatics were compared in a 2 × 2 table of specific allele counts (C versus T) with Fisher's exact test. Similarly, two-sided Fisher's exact tests were used to compare asthmatic subjects with FEV1 values that were > 50% or < 50% of predicted; univariate odds ratios with logit confidence intervals were calculated. Hardy-Weinberg equilibrium was assessed with a goodness-of-fit chi square test. Multiple regression analyses were performed with PROC REG in the SAS package. One-way analysis of variance was used to compare FEV1 (% predicted) and log10 IgE values across genotypes.

To estimate the percentage of variation in FEV1 (% predicted) attributable to the -589 polymorphism, the measured genotype approach developed by Boerwinkle and associates (17, 18) was applied. Non-IL-4 variance was estimated as the mean square error (MSE) in the analysis of variance of FEV1 across IL-4 genotypes. The proportion of total variance related to the IL-4 polymorphism was calculated as the following ratio: (IL-4-related variance)/(IL-4-related variance + MSE).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Subjects Enrolled

The baseline characteristics of the 772 subjects are listed in Table 1. Pulmonary function tests were performed by 771 subjects and total plasma IgE titers were assessed in 678 patients. FEV1 values of > 50% and < 50% were used to categorize high or low lung function levels.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 1

BASELINE CLINICAL CHARACTERISTICS OF ASTHMATIC PATIENTS ENROLLED IN A STUDY OF GENETIC EFFECTS ON ASTHMA SEVERITY

Allele Frequencies

Allele frequencies differed significantly (p = 1 × 10-23) between African American and white asthmatics (Table 2). Of the 682 Caucasians evaluated, 460 (67.4%) were homozygous for the wild-type allele (CC), 195 (28.6%) were heterozygous for the C and T alleles, and 27 (4.0%) were homozygous for the mutant TT allele. Among the 90 African Americans evaluated, 19 (21.1%) were homozygous for the wild-type allele, 44 (48.9%) were heterozygous, and 27 (30.0%) were homozygous for the TT allele. Thus, the frequency of the T allele was 0.183 and 0.544 among whites and African Americans, respectively; the observed distribution of genotypes within each racial group was consistent with Hardy-Weinberg equilibrium. Because the difference in allele frequency between races was highly significant, subsequent analyses of FEV1 and IgE levels were stratified by race.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 2

ALLELE FREQUENCIES AND HARDY-WEINBERG ANALYSIS OF 772 PATIENTS WITH ASTHMA

Association with FEV1 Values

Among whites, the presence of the mutant IL-4 promoter allele was associated with a FEV1 below 50% of predicted (p = 0.013) (Table 3). Multiple regression analysis of FEV1 in white asthmatics was performed with log10 IgE titer and number of T alleles (0/1/2) as dependent variables. The number of T alleles was significantly associated (p = 0.035) with low FEV1 values independent of IgE level. A FEV1 below 50% of predicted was documented for 59.3% of the 27 white patients with a TT genotype but for only 33.9% of the 460 white patients with a CC genotype. A FEV1 below 50% of predicted was not significantly associated with the mutant allele among African Americans (p = 0.88). Furthermore, the distribution of FEV1 values among white subjects with a TT genotype was markedly skewed (Figure 1). The estimated variance attributable to this genetic locus in FEV1 was 0.6% when calculated by the method of Boerwinkle and colleagues (17, 18).

                              
View this table:
[in this window]
[in a new window]
 

TABLE 3

RELATIONSHIP OF IL-4 PROMOTER GENOTYPE TO ASTHMA SEVERITY


View larger version (27K):
[in this window]
[in a new window]
 
Figure 1.   Population density plots for FEV1 in white asthmatics stratified by genotype at the IL-4 promoter locus. Note that the homozygous T/T population has a lower mean and standard deviation than the homozygous C/C population.

Analysis of variance revealed no statistical relationship between the IL-4 promoter genotype and the log10 plasma IgE level. The mean log10 IgE titers by IL-4 promoter genotype are shown in Table 4.

                              
View this table:
[in this window]
[in a new window]
 

TABLE 4

LOG10 IgE TITERS BY GENOTYPE

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

We have demonstrated an association between FEV1 in white individuals, in the absence of chronic controller asthma treatment, and genotype at the C-589T IL-4 promoter locus. To our knowledge, this is the first report of an association between a genetic marker and disease severity in a cohort of patients with asthma. Because we found no association between plasma IgE level and genotype at this locus, our results indicate that genotype at this locus is a marker for a single component of the asthmatic phenotype examined in this study, namely, severity of airflow obstruction as indicated by the FEV1.

The study cohort consisted of patients who were participating in a clinical trial of a novel asthma treatment. All patients enrolled in the trial had stable asthma, as indicated by the absence of asthma exacerbations during a lack of treatment other than as-needed inhaled medium-acting beta -agonists. Because the FEV1 was measured at least 8 h after the use of inhaled beta -agonists, this value was presumably an acceptable index of asthma severity. The study criteria eliminated subjects whose initial FEV1 values were < 40% or > 80% of predicted. Thus it is not surprising that the mean FEV1 of 55.4 ± 12.1% in the entire study cohort indicated a moderate to severe overall level of asthma disease severity. Furthermore, since fewer than 1% of the subjects enrolled in the trial had FEV1 values > 80% of predicted, very few subjects met the current criteria for mild asthma; it is possible that this genetic locus may not contribute to the variation in the FEV1 in patients with mild forms of asthma. However, even with this cohort of patients whose range of FEV1 values was limited, we found a significant association between FEV1 and genotype at the IL-4 promoter locus. The modest size of our sample of African Americans may have accounted for our inability to demonstrate an association between asthma severity and genotype at the IL-4 promoter locus in this group. Moreover, the FEV1 values reflected greater asthma severity in the African American cohort (< 50% of predicted in 47.2% of subjects) than in the white cohort (< 50% of predicted 36.4% of subjects).

Among white asthmatics, there was a difference of 4.5 percentage points of predicted in FEV1 between subjects with the TT and those with the CC genotypes; our data explain 0.6% of the variance in FEV1 observed in our study cohort. Studies of other complex diseases such as diabetes (19, 20) and hypertension (21), indicate that there may not be major loci that account for a large fraction of the total variance in airway obstruction. Rather, we speculate that it is more likely that each of a number of loci accounts for a small fraction of the total variance in lung function.

We found no association between genotype at the IL-4 promoter locus and IgE level. Although elevated IgE levels are strongly associated with bronchial hyperresponsiveness and atopy (24, 25), they have not been associated with asthma severity as measured by FEV1. The implication is that the factors responsible for atopy and bronchial responsiveness may be distinct from those associated with FEV1. Indeed, the lack of association noted by others (13) between the genotype at this locus and the diagnosis of asthma or atopy may be explained by the association of this genotype with factors mediating the severity of the obstructive response rather than its initiation.

We noted a striking difference in allele frequency at this locus between African American and white asthmatics. Because the overall levels of airway obstruction were similar in the two groups despite these differences in allele frequency, there is additional reason to believe that this locus is only one of many that influence the severity of airway obstruction in asthma.

We have identified a significant association between genotype at the IL-4 promoter locus and FEV1 in Caucasian patients with asthma of moderate severity. This locus accounts for 0.6% of the variance in FEV1 in this population, with a genotype-attributable difference in FEV1 of 4.5 percentage points of predicted between subjects homozygous for the wild-type IL-4 promoter and those homozygous for the mutant form. Whether IL-4 itself is the link between asthma severity and genotype at this locus remains unknown. Nevertheless, knowledge of a patient's genotype at this locus serves as an independent index of asthma severity in white patients.

    Footnotes

Correspondence and requests for reprints should be addressed to Jeffrey M. Drazen, M.D., Pulmonary Division, Brigham and Women's Hospital, 75 Francis Street, Boston, MA 02115. E-mail: jdrazen{at}rics.bwh.harvard.edu

(Received in original form December 2, 1998 and in revised form March 22, 1999).

Acknowledgments: Supported by Grant P50-HL-56383 from the National Heart, Lung, and Blood Institute.
    References
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1. Newman-Taylor, A.. 1995. Environmental determinants of asthma. Lancet 345: 296-299 [Medline].

2. Becklake, M. R., and P. Ernst. 1997. Environmental factors. Lancet 350: 10-13 .

3. Postma, D. S., E. R. Bleecker, P. J. Amelung, K. J. Holroyd, J. F. Xu, C. I. M. Panhuysen, D. A. Meyers, and R. C. Levitt. 1995. Genetic susceptibility to asthma---bronchial hyperresponsiveness coinherited with a major gene for atopy. N. Engl. J. Med. 333: 894-900 [Abstract/Free Full Text].

4. Daniels, S. E., S. Bhattacharrya, A. James, N. I. Leaves, A. Young, M. R. Hill, J. A. Faux, G. F. Ryan, P. N. Lesouef, G. M. Lathrop, A. W. Musk, and W. O. C. M. Cookson. 1996. A genome-wide search for quantitative trait loci underlying asthma. Nature 383: 247-250 [Medline].

5. Thomas, N. S., J. Wilkinson, and S. T. Holgate. 1997. The candidate region approach to the genetics of asthma and allergy. Am. J. Respir. Crit. Care Med. 156: S144-S151 [Abstract/Free Full Text].

6. Laitinen, T., M. Rasanen, J. Kaprio, M. Koskenvuo, and L. A. Laitinen. 1998. Importance of genetic factors in adolescent asthma: a population-based twin-family study. Am. J. Respir. Crit. Care Med. 157: 1073-1078 [Abstract/Free Full Text].

7. Collaborative Study on the Genetics of Asthma. 1997. A genome-wide search for asthma susceptibility loci in ethnically diverse populations. Nat. Genet. 15: 389-392 [Medline].

8. Meyers, D. A., T. H. Beaty, C. R. Colyer, and D. G. Marsh. 1991. Genetics of total serum IgE levels: a regressive model approach to segregation analysis. Genet. Epidemiol. 8: 351-359 [Medline].

9. Marsh, D. G., J. D. Neely, D. R. Breazeale, B. Ghosh, L. R. Freidhoff, E. Ehrlichkautzky, C. Schou, G. Krishnaswamy, and T. H. Beaty. 1994. Linkage analysis of IL4 and other chromosome 5q31.1 markers and total serum immunoglobulin E concentrations. Science 264: 1152-1156 [Abstract/Free Full Text].

10. Borish, L., J. J. Mascali, M. Klinnert, M. Leppert, and L. J. Rosenwasser. 1995. SSC polymorphisms in interleukin genes. Hum. Mol. Genet. 4: 974 [Abstract/Free Full Text].

11. Kawashima, T., E. Noguchi, T. Arinami, K. Yamakawa, Kobayashi, H. Nakagawa, F. Otsuka, and H. Hamaguchi. 1998. Linkage and association of an interleukin 4 gene polymorphism with atopic dermatitis in Japanese families. J. Med. Genet. 35: 502-504 [Abstract/Free Full Text].

12. Noguchi, E., M. Shibasaki, T. Arinami, K. Takeda, Y. Yokouchi, T. Kawashima, H. Yanagi, A. Matsui, and H. Hamaguchi. 1998. Association of asthma and the interleukin-4 promoter gene in Japanese. Clin. Exp. Allergy 28: 449-453 [Medline].

13. Walley, A. J., and W. O. C. M. Cookson. 1996. Investigation of an interleukin-4 promoter polymorphism for associations with asthma and atopy. J. Med.Genet. 33: 689-692 . [Abstract/Free Full Text]

14. Coleman, J. W., M. R. Holliday, I. Kimber, K. M. Zsebo, and S. J. Galli. 1993. Regulation of mouse peritoneal mast cell secretory function by stem cell factor, IL-3 or IL-4. J. Immunol. 150: 556-562 [Abstract].

15. American Thoracic Society. 1987. Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease (COPD) and asthma. Am. Rev. Respir. Dis. 136: 225-244 [Medline].

16. American Thoracic Society. 1987. Standardization of spirometry: 1987 update. Am. Rev. Respir. Dis. 136: 1285-1298 [Medline].

17. Boerwinkle, E., and G. Utermann. 1988. Simultaneous effects of the apolipoprotein E polymorphism on apolipoprotein E, apolipoprotein B, and cholesterol metabolism. Am. J. Hum. Genet. 42: 104-112 [Medline].

18. Boerwinkle, E., and C. F. Sing. 1986. Bias of the contribution of single-locus effects to the variance of a quantitative trait. Am. J. Hum. Genet. 39: 137-144 [Medline].

19. Spielman, R. S., R. E. McGinnis, and W. J. Ewens. 1993. Transmission test for linkage disequilibrium: the insulin gene region and insulin- dependent diabetes mellitus (IDDM). Am. J. Hum. Genet. 52: 506-516 [Medline].

20. Pociot, F., R. Veijola, J. Johannesen, P. M. Hansen, T. Lorenzen, A. E. Karlsen, H. Reijonen, M. Knip, and J. Nerup. 1997. Analysis of an interferon-gamma gene (IFNgamma) polymorphism in Danish and Finnish insulin-dependent diabetes mellitus (IDDM) patients and control subjects. J. Interferon Cytokine Res. 17: 87-93 [Medline].

21. Watson, B., S. M. Bergman, A. Myracle, D. F. Callen, R. T. Acton, and D. G. Warnock. 1996. Genetic association of 11 beta-hydroxysteroid dehydrogenase type 2 (HSD11b2) flanking microsatellites with essential hypertension in blacks. Hypertension 28: 478-482 [Abstract/Free Full Text].

22. Nakayama, T., M. Soma, Y. Takahashi, Y. Izumi, K. Kanmatsuse, and M. Esumi. 1997. Association analysis of CA repeat polymorphism of the endothelial nitric oxide synthase gene with essential hypertension in Japanese. Clin. Genet. 51: 26-30 [Medline].

23. O'Donnell, C. J., K. Lindpaintner, M. G. Larson, V. S. Rao, J. M. Ordovas, E. J. Schaefer, R. H. Myers, and D. Levy. 1998. Evidence for association and genetic linkage of the angiotensin-converting enzyme locus with hypertension and blood pressure in men but not women in the Framingham Heart Study. Circulation 97: 1766-1772 [Abstract/Free Full Text].

24. Sears, M. R., B. Burrows, E. M. Flannery, G. P. Herbison, C. J. Hewitt, and M. D. Holdaway. 1991. Relation between airway responsiveness and serum IgE in children with asthma and in apparently normal children. N. Engl. J. Med. 325: 1067-1071 [Abstract].

25. Burrows, B., M. R. Sears, E. M. Flannery, G. P. Herbison, and M. D. Holdaway. 1995. Relations of bronchial responsiveness to allergy skin test reactivity, lung function, respiratory symptoms, and diagnoses in thirteen-year-old New Zealand children. J. Allergy Clin. Immunol. 95: 548-556 [Medline].





This article has been cited by other articles:


Home page
Social Studies of ScienceHome page
D. Fullwiley
The Biologistical Construction of Race: `Admixture' Technology and the New Genetic Medicine
Social Studies of Science, October 1, 2008; 38(5): 695 - 735.
[Abstract] [PDF]


Home page
Hum Mol GenetHome page
M. A. Seibold, B. Wang, C. Eng, G. Kumar, K. B. Beckman, S. Sen, S. Choudhry, K. Meade, M. Lenoir, H. G. Watson, et al.
An african-specific functional polymorphism in KCNMB1 shows sex-specific association with asthma severity
Hum. Mol. Genet., September 1, 2008; 17(17): 2681 - 2690.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
C. V. Scirica and J. C. Celedon
Genetics of Asthma: Potential Implications for Reducing Asthma Disparities
Chest, November 1, 2007; 132(5_suppl): 770S - 781S.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
N. C. Battle, S. Choudhry, H.-J. Tsai, C. Eng, G. Kumar, K. B. Beckman, M. Naqvi, K. Meade, H. G. Watson, M. LeNoir, et al.
Ethnicity-specific Gene-Gene Interaction between IL-13 and IL-4R{alpha} among African Americans with Asthma
Am. J. Respir. Crit. Care Med., May 1, 2007; 175(9): 881 - 887.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. E. Wenzel, S. Balzar, E. Ampleford, G. A. Hawkins, W. W. Busse, W. J. Calhoun, M. Castro, K. F. Chung, S. Erzurum, B. Gaston, et al.
IL4R{alpha} Mutations Are Associated with Asthma Exacerbations and Mast Cell/IgE Expression
Am. J. Respir. Crit. Care Med., March 15, 2007; 175(6): 570 - 576.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
P. N. Le Souef, P. Candelaria, and J. Goldblatt
Evolution and respiratory genetics
Eur. Respir. J., December 1, 2006; 28(6): 1258 - 1263.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
S. N. Georas, J. Guo, U. De Fanis, and V. Casolaro
T-helper cell type-2 regulation in allergic disease
Eur. Respir. J., December 1, 2005; 26(6): 1119 - 1137.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. Wenzel
Severe Asthma in Adults
Am. J. Respir. Crit. Care Med., July 15, 2005; 172(2): 149 - 160.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
M. J. Federico, R. A. Covar, E. E. Brown, D. Y. M. Leung, and J. D. Spahn
Racial Differences in T-Lymphocyte Response to Glucocorticoids
Chest, February 1, 2005; 127(2): 571 - 578.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
S. N. Georas
Inhaled Glucocorticoids, Lymphocytes, and Dendritic Cells in Asthma and Obstructive Lung Diseases
Proceedings of the ATS, November 1, 2004; 1(3): 215 - 221.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
E. R. McFadden Jr.
Acute Severe Asthma
Am. J. Respir. Crit. Care Med., October 1, 2003; 168(7): 740 - 759.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
S. Wenzel
Severe/Fatal Asthma
Chest, March 1, 2003; 123(2007): 405S - 410S.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
S. J. Szefler
Pediatric Asthma: An Approach to Pharmacogenetics Analysis
Chest, March 1, 2003; 123(2007): 434S - 438S.
[Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
T. Shikanai, E. S. Silverman, B. W. Morse, C. M. Lilly, H. Inoue, and J. M. Drazen
Sequence variants in the Fcepsilon RI alpha chain gene
J Appl Physiol, July 1, 2002; 93(1): 37 - 41.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
I. PIN, V. SIROUX, C. CANS, F. KAUFFMANN, J. MACCARIO, C. PISON, and M.-H. DIZIER
Familial Resemblance of Asthma Severity in the EGEA* Study
Am. J. Respir. Crit. Care Med., January 15, 2002; 165(2): 185 - 189.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
H. HAKONARSON, U. S. BJORNSDOTTIR, E. OSTERMANN, T. ARNASON, A. E. ADALSTEINSDOTTIR, E. HALAPI, D. SHKOLNY, K. KRISTJANSSON, S. A. GUDNADOTTIR, M. L. FRIGGE, et al.
Allelic Frequencies and Patterns of Single-nucleotide Polymorphisms in Candidate Genes for Asthma and Atopy in Iceland
Am. J. Respir. Crit. Care Med., December 1, 2001; 164(11): 2036 - 2044.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
J-C Renauld
New insights into the role of cytokines in asthma
J. Clin. Pathol., August 1, 2001; 54(8): 577 - 589.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. C. Keen, L. Sholl, M. Wills-Karp, and S. N. Georas
Preferential Activation of Nuclear Factor of Activated T Cells c Correlates with Mouse Strain Susceptibility to Allergic Responses and Interleukin-4 Gene Expression
Am. J. Respir. Cell Mol. Biol., January 1, 2001; 24(1): 58 - 65.
[Abstract] [Full Text]


Home page
Am. J. Respir. Crit. Care Med.Home page
S. Wenzel
Proceedings of the ATS Workshop on Refractory Asthma . Current Understanding, Recommendations, and Unanswered Questions
Am. J. Respir. Crit. Care Med., December 1, 2000; 162(6): 2341 - 2351.
[Full Text]


Home page
ThoraxHome page
J M HOPKIN
Atopy, asthma, and the mycobacteria
Thorax, June 1, 2000; 55(6): 443 - 445.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by BURCHARD, E. G.
Right arrow Articles by DRAZEN, J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BURCHARD, E. G.
Right arrow Articles by DRAZEN, J. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Proc. Am. Thorac. Soc. Am. J. Respir. Cell Mol. Biol.
Copyright © 1999 American Thoracic Society